Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig25
Contig Information
Length 1494 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12g07    rwhv16n12g07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0574800 [Oryza sativa (japonica cultivar-group)] >gi|12643061|gb|AAK00450.1|AC060755_20 unknown protein [Oryza sativa] >gi|31433652|gb|AAP55136.1| GTPase activating protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113640009|dbj|BAF27314.1| Os10g0574800 [Oryza sativa (japonica cultivar-group)]
Score 1499
Evalue 3.90952e-164
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig25
GGCTCGCGCCCGATCGGCTTGGTGGCTCGCCGCGATGGCGACCGACGCCGGCGCCGCCGACAGGAGCTCCGTCTTCCGCAAGCTCCGCGCCAAATCCGAC
AATAAGATGTGCTTCGACTGCAACGCCAAGAACCCCACCTGGGCCTCCGTCACCTACGGCGTCTTCCTCTGCATCGACTGCTCCGCCGTCCACCGCAGCC
TCGGCGTCCACGTCTCCTTCGTCAGGTCAACAAATTTGGATTCATGGACCCCAGAACAGTTGAAAATGATGGTTTATGGGGGAAACAACCGTGCACAAGC
TTTCTTTAAGCAGCATGGTTGGACTGATGGTGGAAAGATTGAGGCAAAGTACACTTCAAGAGCTGCTGACTTATACAGACAGTTGCTCCTCAAAGAGGTT
TCTAAAAGTTCCACAGAAGATGGCAATAATAGTGGGCCGCCCTCCCCAGTCGCAGCTTCTCAGACTTCAAGCCAAGCAGCTGCATTTCCTGATTTCAAAC
TGGCAGAGGTGCCGAAAGTAGTTGTAAATGAGAAGAATGAGCCTGAGTCTGAAACTATTCGTTCACCTAAAGCTCCTACCCATTCATTCAAGAAGCCAAT
CGGTGGAAAGAAGCCTGGAAGTAAGACTGGTGGACTTGGTGCGCGCAAGCTTACGACAAAGCCAAGTGAAAGCCTCTATGAGCAGAAACCTGAAGAGCCA
GCTCCTGCCCTGCCATCAGTGGCTGAAAGCACTACAGCTAGGAGCAAATCTCATACTTCCCGATTTGAATATGTGGAAAATGTACCTTCTGCTGGGAGCA
GCTCTGCGGAAAACCAGGCGTTTGGGCATGTTGCGCCCCCAAAGTCTTCAAACTTTTTTGGTGAATACGGGATGGACAGTGGATATCACAAGAAATCTAC
TTCTGGTGCATCCAAAATGCAGGTCGAGGAAAGTAGCGAAGCAAGACAGAAGTTCTCAAATGCAAAGTCTATTTCATCTTCTCAGTTTTTCGGTGATCAA
GCCAATTTAGAAAAAGAGGGCCAAATCTCCCTCCAAAAATTCTCTGGATCCTCTGCCATTTCAAGTGCTGATCTGTTTGGCCAACAAGCGAACAATTCTA
ATGCCGATCTGAGTGCTTCGGATTTGATCAACAGAATCTCCTTCCAGGCCACTCAGGACTTGACCTCTCTCAAGAGCATGGCTGGGCAGACTGGGAAGAA
GCTGACATCTATGGCGTCCAACATCATATCTGATCTTGACCGGATCCTCTGAGCTGAATTTACAGTCAAGACTCTATCACAGGCCTTCGGCGGTCCGCCT
CTCCTGATTGTTAGAGCATGACAACAGATTGGTGGTGGCTCTGTATAAGAGTCCATAGGAATCTTAAAACTTAAAGTCGGTAGAGAAAGAATGAGGATTT
TCTCGCAAATGCTTTCTGGCTAAAGTCGTAATAGCATTTGGAGTTTCGTGGGAACCAGATGGGTGTTGTGCTACCAAAGAAAATGCCTTTGCTT
page-top