Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig22
Contig Information
Length 1337 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12f20    rwhv16n12f20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_03906 [Oryza sativa Indica Group]
Score 1187
Evalue 5.08109e-128
Total Hit Count 172
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig22
CGACATCCCAATGTATCTTCTTTCTTTGAATATGTCCATAATAGACAGGTTGTGCACTTCAGATTGCTTGAAAAGCCAAAACAAGACGACTTCTCTCTAG
AACTATCAAAACGTTCCACATATGATGATGTTGTTGAGAAAGTTGCACAACATCTTGGTATGGATGATCCTTCAAAACTCCGCCTTACTCAGCACATCCC
TCATTTACAGCAACCGAAACATCAATACATCAAGTATAGAAGTATTGATCATCTTTCGGACATGTTACTTTTACGTAACCCCAATCAGATGTCTGACATT
TTATATTATGAAATACTGGACATTCCTTTGCCAGAACTGCAAGGTCTGATAACATTGAGAGTTGCTTTTCACCAAGCTACACCTAATGAGGTGCTGTTTC
ACATTATACGATTGCCAAAGGGTAGCACTTATTCTGATTTGATCGACGACTTAAAATCAAAGGTTCAGCTATCTCGAAGTGATGCTGAGCTTAGGCTATT
TCAGGTCAACAATAACAAGATATGGAAGGTGTACCTGCCTACTGAGAAAATAGATGCAGTTCATGATCCAAATGTACCTCTTCATGTTGAGGAGATTCCT
GAAGTAGAGAAAAGTGCCGGTCCGCGAGACCGTTTGGTTCATGTCGTCCACTTCTTCAAAGATAACCAGCACATTCAATACTATGGACTGCCATTCTTCT
TCCTTATTCGTGAGGGTGAGGCTTTGTCAGATATCAAAGTGCGCATTCAAAAGAAATTTGAGGTTCCAGACGAGCAGTTTCTTAAGTGGAAATTTGCTTA
TGTTGCCTACAATCGCCCGGATTACCTTCAAGATTCAGATATTGTGTTGAGCCGATTCCAGAAAAACATTTATGGACCATGGGAACAATCCCTAGGACTG
GAGCACTCAGACATGCCCACCAAAAGGGCCAATCAGAATCGCCATTCTTTTGAAAAGCCGGTGAAGATCTACAACTAAAGATGCCGATATTTTCAGTTCT
GACCTGACGGTTTCTCTAAACGAATGGGCAAGAACACCAATGTTATTTACGCACACCCTGCAGATGAAGTGGCGGCAAAATCCATGACCATGATGTGCTT
TTGACCCGGTAGTTATACAGATGTAGTACCGGCTGTTGAGAGGGTGCTGTGCTGAGTTATTATTTGTTTGGAGGGGACGTTGCATACAGCGGATGTATTG
TGGCTTGTCGAAAGGAAATTAACATTTGGTTGGCTGTACAGTGATTGATAGAACTTTTTTGCTTAGATCAATTTAACTTTGTAAGCTGTGTATTTTGCAG
TGAATTTTTGCACCTCGGTTGATTCTGTGGTCGTGCC
page-top