Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig21
Contig Information
Length 1132 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12f19    rwhv16n12f19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Hordeum vulgare]
Score 1189
Evalue 2.34001e-128
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig21
TTCTTGCGGCACAAGCCGGAGCCGACGATCCCCTCGCCCGCGCCGCCGTCGACGCGGCCTCTTCCGCTCGCCGGGATCGGAGAGAACTGTATAAACGGTT
CGGTGATTGAAGCGACTTAAGTCTTAACCATGAGTAGCATAGGAACCGGGTATGATCTGTCCGTCACCACTTTCTCCCCGGACGGCCGTGTCTTCCAGGT
CGAGTATGCTGGCAAGGCCGTCGACAACAGCGGGACGATTGTTGGGATCAAGTGCAAAGATGGAGTTGTCCTCGGTGTGGAGAAGCTGATAACATCGAAG
ATGATACTTGCCGGGTCGAATCGGAGACTTCACTCTGTTCACCGGAACTCTGGCTTGGCTGTGGCTGGGTTAGCAGCAGACGGTAGGCAGGTGGTCTCCA
GAGCAAAGTCAGAAGCTGCCAATTATGAAAAGGTATACGGAGAACCCATGCCTGTGAAGGAATTAGCTGATCGTGTAGCTAGCTACGTTCATCTGTGTAC
ACTCTACTGGTGGCTCAGGCCTTTTGGCTGTGGAGTTATTCTTGGAGGTTATGATAGGGATGGGCCACAGCTCTACATGATCGAACCTTCAGGGCTCTCA
TATAAATATTTTGGTGCTGCTCTGGGTAAAGGAAGACAGGCTGCAAAAACGGAGATAGAGAAATTGAAGCTTTCTGAGCTAACCTGCAGGGAAGGCATTG
TTGAGGTTGCCAAGATAATTTATGGTGTACACGATGAAGCGAAAGACAAATCTTTTGAGCTGGAACTGAGCTGGGTGTGCGATGAATCTAACCGTCAGCA
TGAGAAGGTTCCAAATGATCTTCTGGAGCAGGCCAAGGCAGCAGCGCAGGCAGCGTTGGAAGAGATGGACGCCGACTAAGAAGAGACCATGAGCTCTGCT
CCCCATTTACTTTCACGTGCTCGGCGTAACAGATACCGGACTGGAGCGGTTCGTTTTCAGTGCAAAAAACTACCTTCAGGCGTTGTTGCTTACGGTTCCA
TGATTCCATCCCAGTTGAGGTAGCAAGCAGGTTCTCGTGTTTTGGGGGGTTGTAGCGAATCGTGTTCTGCTTGCTGTTGGTCACACACTGAATCTTAATC
CATTGAAATCCGAACATGTTGTCACAGATCTA
page-top