Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig16
Contig Information
Length 1117 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12a23    rwhv16n12a23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0963300 [Oryza sativa (japonica cultivar-group)] >gi|57899182|dbj|BAD87234.1| putative syntaxin 6 [Oryza sativa Japonica Group] >gi|113535016|dbj|BAF07399.1| Os01g0963300 [Oryza sativa (japonica cultivar-group)] >gi|215695277|dbj|BAG90468.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218189790|gb|EEC72217.1| hypothetical protein OsI_05319 [Oryza sativa Indica Group]
Score 143
Evalue 4.51482e-07
Total Hit Count 30
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig16
CTCGTCGCAGCCTACGGCGCCCGATGCCGCCCGATTCCTCCACCCTCCGACGGCGCCTGATGCCTTCTCCTCCGCTCCATCCTCCACTTGGACTAGATCT
GGCGCGCACGTCCCACACATCGACCGTGCCCTCCCACCCACACATCGCCACCACCACCCACCGTCCCGTCTGACCTTGCCGCCTCCACCCATGCCGCATC
TGACCTCGTCTCCGGCCGCCGCTCCCGCTCTCCCCCCCCCTCACACACACACACCAGGGCTTCGATCTGGACCTCTGTCTGCACGAGGGGACGTCTGCGC
CTCGTCCTCGTCCCACCTCAGGCGCCAGATCGAGCCGGACTCGTGTCGTCATCAAGAGCCGACCTCGACGGAGATGAGAGGAACCCTTCTTCCTCCGTCT
TCCTTCGACCTCGACCTCGGCATGTTGACCTCGCTCCATAACATCTCGGTGAACCACTACTGGATGTGGCGTCGACTAAGCACTGCACATGGCTTGCTCG
CCGGCACGCGCGTGCGTGCTTCGATGCGCGGCGCTTCGTCGAGCTGGACGGACCGCGGCAATCGCTGGAGCCAGAGCTGGAGGAGGCGACGAGATGCTGC
TGCTGCGGCTGTGTCCTCGGAGGCAGTTGCTGCCCCTCGCCGACCTCACCAACATCCGGCGTCCGCCATGAGCTCCCCGCAGGACCCCTTCTACATCGTC
CGGGAGGAGATCCAGGGCTCGATGGGTAAGCTGCAGACTACGTTCCATCGCTGGAAGCAAGTTTCTTCAAACCTGATTACTTTGTCATCAGGCTGGCTGA
TTGCATCCAGCTCAAATTGTTCCACATTTCTAGCTTAAGGGTTCCACTTGCACATGATGGCCCCCAACTCCTTATGGCAAGCAGTTTCTCCAGCTGACAA
CAAGGTTAATTATTAAGCATACGAGAACATATTCATGAAAGTTCTGTTAGTAGGTGGATGGCTTCTAGTTCTAAATGATTTGGAAGCTGGGAATCTGGGG
AATGCAAAGTTGAAGAGACCTGGAGTATCTATACTGTGATTGCCATTGTATATGTGTTATATGATGATGTAACACAATGATTCTGCTATTGTATCTTTGT
TGTATGATGTATCAAAC
page-top