Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig15
Contig Information
Length 838 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n3n16    rwhv16n3n16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38560 [Oryza sativa Indica Group]
Score 1038
Evalue 4.68935e-111
Total Hit Count 62
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig15
GTTCTACCAGTTGTCTATGGTATCTGAGAATGAAGGTGCTTTTCTATTTAAGCTGAGATTGATGGAGGGTTACAAGTCCCCGTTTCTTATGGAATTTTGC
ATGGTCACAATGCCATTTCCTCGAAGAAGAGTTGCATCATATGACGGAAATCCATCAGTTGGGACGGTTTCAATGACAGAACATTTAATTGAGTGGAGAA
TTGTTTCAAGTGGCCGGGGCCTCAGTGGTAGGAGCATTGAAGCTACCTTCTCTGGTACTGTTAGATTTCATCCTAGAACAACGCAGCGAGTAAATTCATC
ATTTCGGTCGGCCACAACCACCGCATTTGCTGAAGATAGTGATTGTGAGCAAGATATCACTAAGAATGGTGCCAACTTGGATGACTACCTCATGGAAAAA
ATGAACAAAGACCTTCAAGCAGTTGACTTGGAAGAGCCATTGTCTTGGCAGGCTTATAATTATGCTAAGGTGTCGTTTAAGATAGTTGGTGGCACCCTGT
CTGGTCTTATAATCGACCCAAGATCTGTAACCATTTACCCTTCTGTCAAAGCCCCAGTAGAATATTCAATGCAGGCCTCTTCTGGAGACTACATACTATG
GAATACCTTAGGAAAATGTCCTTCTGCAGCTTTGCCAAAAGAATTATAATTGCCAGTGTTCATCGCCAGGCACGGTCCTCAACGGTTTTTTGGTCCCACC
AGAGCTGTGCTGGAAGTTCTCTTTTAGTTCTTATATAATTGAGGAAAATAGTGTTTCAAGTGGGAAACAGATCCTGTACATCATTTTTGTCAGACAAGTT
TGTATGCTGAGCTTANATTTCATGGCTCAAAAAAAAAA
page-top