Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig12
Contig Information
Length 600 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12e08    rwhv16n12e08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit light-harvesting complex IIa protein;
Score 633
Evalue 2.14097e-64
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig12
GCAGGACGCCGGCAAGGTGGAGCTGGTGGACGGGTCGTCGTACCTGGGGCAGCCGCTGCCGTTCACGCTCACCACGCTGATCTGGATCGAGGTGCTGGTG
ATCGGGTACATCGAGTTCCAGCGCAACGCGGAGCTGGACCCGGAGAGGAGGCTCTACCCCGGTGGCTCCTACTTCGACCCGCTGGGTCTCGCGGCGGACC
CGGAGAAGAAGGAGACTCTGCAGCTGGCGGAGATCAAGCACGCCCGCCTCGCCATGGTCGCCTTCCTCGGCTTCGCCGTGCAGGCCGCCGCCACCGGCAA
GGGGCCGCTCAACAACTGGGCCACCCACCTCAGCGACCCGCTGCACACCACCATCTTCGACACCTTGGGCTCCTCTTAAGTGGTCGGTGGTCGAGCAATT
TCTGTCAGCTCGGCTGCAAAATGGACGAACGCGCGTCCGTGTAACGAACGTGCTTTTCGTTTTGTATATGACGAGTGATGGATGAGAGGGTATCGCAAAG
ATCCTTTGTTGAGTAATGCAGGTCTGATCACATAGGAGAGCTGCTGGGACTTGGTGATTTGTAAAATATGAACCAATGGTGACTTAATGCAAAAAAAAAA
page-top