Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig7
Contig Information
Length 750 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n4a02    rwhv16n4a02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09810 [Oryza sativa Indica Group]
Score 469
Evalue 3.60012e-45
Total Hit Count 38
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig7
AGATTGCGAAAAAGCTCATGCCAGATGGTCGAATCATGGTCAACTGCGGTGGAGCAGATACCCCCGTATCTCTTGCTGCCGACACGGGTGTTTCGTCTTG
GGTCCAGAATCCTACAATCAAGGCTCTGTGCTCTGCGTTCCCTGGGCAGCTAAACTGGAAGAGACTTTCGGAGAAGGAGAGTGTAAACTACGTCGCGTTG
ACGGGTCCCCTTCCAGACCTGGAGGAGTGGTCAACCTCGGTTCCTAGCGAGCTAAGCCCAAGAGTGAAACAATGGGTGCCTTGCGAGCTCGCGTGAGAAT
GTGCGTTTTCTTCTGGTTGCACCTTTGCTTGCTTCTACAACTTTGTCTGTCTCCCCCCTCCACGGTCCTTTTAAGGTGTACATAAGGCCATCTGTCTGCA
TCTGAAGAAGTACCATATCATATCAGCACTCACATGTCCAAGGAAGGAATTGCAATGTGGAAGGTAGTCTATCTGGCTCCCAAAGCTTGAAGAACAGCAG
AGCGAAGACCTGTCCGTTTAATGGAGTTGATGCGTGTAATCCTGAAACCGAGCCGAGGGAAGAACGCATCGCGCTACAGTTTTTGGCATGTCCTGCTGCC
CTGCTGTTGATTATCATTCATCATTCCATGCCTTCATGGTGTCACAGTGTCAAGTTCAGACGGTGATTAGTAAGCGCGCGTTACATTACATCCCTTTGTT
TTTTTAGGTAACAACCTCTTATTTTTCTGTTGTATACACGAAAAAAAAAA
page-top