Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig500
Contig Information
Length 676 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10d13    rwhgc10d13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0521700 [Oryza sativa (japonica cultivar-group)] >gi|49388919|dbj|BAD26141.1| unknown protein [Oryza sativa Japonica Group] >gi|113536508|dbj|BAF08891.1| Os02g0521700 [Oryza sativa (japonica cultivar-group)] >gi|125539680|gb|EAY86075.1| hypothetical protein OsI_07443 [Oryza sativa Indica Group] >gi|125582321|gb|EAZ23252.1| hypothetical protein OsJ_006735 [Oryza sativa (japonica cultivar-group)] >gi|215693151|dbj|BAG88533.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215697016|dbj|BAG91010.1| unnamed protein product [Oryza sativa Japonica Group]
Score 411
Evalue 1.55173e-38
Total Hit Count 50
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig500
AGAAAGATAATCATCAGGCAGAGCTGCAGCAGGTGGCCATGGCCGACTCCCCCGAGTTAGCTCGTGCTCGGGACGTCCTGAGCGTGCGCGCCGACGAGCA
CGCGCGGGTGGACGCGCTCTCCTCCGCCGCATCCGCATCCGCATCCCTATCATCGGCCACTACTCATCTGTCGCCGAGCTTCTTCGAGGGATTCGCGCTG
CGCGGGATCCGCGTGCTCCGCCTCCATCCGGGGTTCATCCACTGCTCCTACACCGTCCCCCCGAGCCTCACCGACTCCACCACCGGCTGCCTCGCCGCCG
GTGCCGTTGTCGCCCTGGTCGACGAGATCGGCTCCGCCGCCTCCATCTCCGAAGGCCAAAACCTCAAGGTCTCCGTCGACATGTCCGTCGCCTTCCCCGA
TCTCTCCCAGGCCCGCCCGGGGGACCGGCTGAGCATAACGGCAAGGGCGCTCGGACACAAGGGCGCCTACTCCGGCACACACGTGCTCTTCACCAACGCC
GGCACCGGCAACGTCGTCGCCGAGGGCAGGCACTCCCTCTTCGGTAACATGAAGAAGTCGCCACCACCCAAGCCAGCAGCCACTACTCACAGGAGCAACT
TGTGATGATGCCTCTGCCTGCCTGCTCCTACTCCACTATTCTATTCTGTATTCTGATGAAGAGTACTTGTCATCAG
page-top