Top | About the KOMUGI | Related Sites | Update | SiteMap | Contact Us
Quick Search   for   
  Strains ( NBRP / Others ) Genes / Marker cDNA TAC Map Comparative Map BLAST
  DNA Seq. Organelles Chromosomes Microarray eWIS Tools Story of wheat (Japanese only) Textpresso(TEST)
 Japanese | English

  BLAST
  Tissue specific clones
  complex contig list
Query Form

  How to use Virtual Display(2012)

  Related Sites
  Download
  How to Order Resources

  MTA Sample


• > Contig Detail
/images/estsTitleEn2.gif
cDNA - Contig Detail
Wh_GCPCDAM_all.Contig500
Contig Information
Length 676 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones
2 Clones   [Download: CSV , FASTA ]
whgc10d13    rwhgc10d13   
Assemble Result Assemble Viewer *
Homology (BLAST) Top Hit Os02g0521700 [Oryza sativa (japonica cultivar-group)] >gi|49388919|dbj|BAD26141.1| unknown protein [Oryza sativa Japonica Group] >gi|113536508|dbj|BAF08891.1| Os02g0521700 [Oryza sativa (japonica cultivar-group)] >gi|125539680|gb|EAY86075.1| hypothetical protein OsI_07443 [Oryza sativa Indica Group] >gi|125582321|gb|EAZ23252.1| hypothetical protein OsJ_006735 [Oryza sativa (japonica cultivar-group)] >gi|215693151|dbj|BAG88533.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215697016|dbj|BAG91010.1| unnamed protein product [Oryza sativa Japonica Group]
Score 411
Evalue 1.55173e-38
Total Hit Count 50

* Before using this tool, please ensure that you have the latest version of Java.
If you are not using the latest Java version, please download it here.


Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig500
AGAAAGATAATCATCAGGCAGAGCTGCAGCAGGTGGCCATGGCCGACTCC
CCCGAGTTAGCTCGTGCTCGGGACGTCCTGAGCGTGCGCGCCGACGAGCA
CGCGCGGGTGGACGCGCTCTCCTCCGCCGCATCCGCATCCGCATCCCTAT
CATCGGCCACTACTCATCTGTCGCCGAGCTTCTTCGAGGGATTCGCGCTG
CGCGGGATCCGCGTGCTCCGCCTCCATCCGGGGTTCATCCACTGCTCCTA
CACCGTCCCCCCGAGCCTCACCGACTCCACCACCGGCTGCCTCGCCGCCG
GTGCCGTTGTCGCCCTGGTCGACGAGATCGGCTCCGCCGCCTCCATCTCC
GAAGGCCAAAACCTCAAGGTCTCCGTCGACATGTCCGTCGCCTTCCCCGA
TCTCTCCCAGGCCCGCCCGGGGGACCGGCTGAGCATAACGGCAAGGGCGC
TCGGACACAAGGGCGCCTACTCCGGCACACACGTGCTCTTCACCAACGCC
GGCACCGGCAACGTCGTCGCCGAGGGCAGGCACTCCCTCTTCGGTAACAT
GAAGAAGTCGCCACCACCCAAGCCAGCAGCCACTACTCACAGGAGCAACT
TGTGATGATGCCTCTGCCTGCCTGCTCCTACTCCACTATTCTATTCTGTA
TTCTGATGAAGAGTACTTGTCATCAG
 
NBRP MacGene Copyright © 2012 NBRP-Wheat. All rights reserved.