Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_EMI_all.Contig2166
Contig Information
Length 1062 bp
Tissue Dormant seed with water absorption after breaking
Clones 21 Clones [Download: CSV  ,  FASTA ]
whei1b18    whei2h22    whei4d13    whei5b18    whei5p16    whei7f22    whei8o07    whei9c16    whei13b09    whei16h05    whei17o12    rwhei1b18    rwhei2h22    rwhei4d13    rwhei5b18    rwhei5p16    rwhei7f22    rwhei8o07    rwhei9c16    rwhei13b09    rwhei16h05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein [Bromus inermis]
Score 1221
Evalue 4.13947e-132
Total Hit Count 432
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig2166
CGGCGGCGGCGCGTAGCACAGGAGAAGGAGCAGGCGGCGGTGGTGCCCGAAGACGAGAAGCACGGCGACCTAGCCCGAGCTCGCAACCATGGCTAGGGGT
TTGAAGAAGCATCTGAAGAGGCTCAATGCCCCGTCTCACTGGATGCTTGACAAGCTTGGTGGAGCTTTTGCCCCCAAGCCATCATCTGGTCCTCACAAGG
CCAGGGAGTGCCTTCCTCTGATCCTCATCCTGAGGAACAGACTGAAATATGCTCTCACCTACCGTGAAGTGCAGTCTATCCTTATGCAGCGTCATATCAT
GGTTGATGGAAAGGTCCGCACTGACAAGACCTACCCTGCTGGTTTCATGGACATCATTTCCATTCCCAAGACTGGTGAGAACTACAGGCTTCTGTATGAC
ACCAAGGGCCGCTTCCGCCTTCACTCTGTCAGGGATGAGGATGCTAAGTTCAAGCTCTGCAAGGTCAGGTCTGTCCAGTTCGGCCAGAAGGGCATCCCCT
ACCTGAACACCTATGATGGCCGCACCATCCGCTACCCAGACCCTCTCATCAAGGCCAATGACACTATCAAGCTCGACCTGGAGACCAACAAGATTGTTGA
CTTCATCAAGTTCGACGTTGGTAACGTGGTCATGGTGACTGGCGGGCGCAACACTGGGCGTGTTGGTGTGATCAAGAACAGGGAGAAGCATAAGGGAACC
TTCGAGACCATCCACGTTGAGGATGCCCAGGGCCACCAGTTCGCCACCCGTCTGGGCAATGTATTCACCATTGGCAAGGGCACCAAGCCATGGGTGAGCC
TCCCCAAGGGCAAGGGTATCAAGCTCACCATCATTGAGGAGCAGAGGAAGCGGGATGCCGCTGCCCAGGCTGCTGCCAAGGCCTGATTCTGAGGCGTTGA
GTCGTTTTGCTATAGCCAGTTATCTGCAAGGATATAGAACTATGTTCCTGGAACCATCGTTTTTAAGTTTTGCCTGATGTTTGTTGATTTGCGAACTTCG
TGGTTGCCTCTAGATGTAATGTGGATGTTTATCTTATTAAGTGCTATTTCGAGACCTCATCC
page-top