Top | About the KOMUGI | Related Sites | Update | SiteMap | Contact Us
Quick Search   for   
  Strains ( NBRP / Others ) Genes / Marker cDNA TAC Map Comparative Map BLAST
  DNA Seq. Organelles Chromosomes Microarray eWIS Tools Story of wheat (Japanese only) Textpresso(TEST)
 Japanese | English

  BLAST
  Tissue specific clones
  complex contig list
Query Form

  How to use Virtual Display(2012)

  Related Sites
  Download
  How to Order Resources

  MTA Sample


• > Contig Detail
/images/estsTitleEn2.gif
cDNA - Contig Detail
Wh_EMI_all.Contig2166
Contig Information
Length 1062 bp
Tissue Dormant seed with water absorption after breaking
Clones
21 Clones   [Download: CSV , FASTA ]
whei1b18    whei2h22    whei4d13    whei5b18    whei5p16    whei7f22    whei8o07    whei9c16    whei13b09    whei16h05    whei17o12    rwhei1b18    rwhei2h22    rwhei4d13    rwhei5b18    rwhei5p16    rwhei7f22    rwhei8o07    rwhei9c16    rwhei13b09    rwhei16h05   
Assemble Result Assemble Viewer *
Homology (BLAST) Top Hit ribosomal protein [Bromus inermis]
Score 1221
Evalue 4.13947e-132
Total Hit Count 432

* Before using this tool, please ensure that you have the latest version of Java.
If you are not using the latest Java version, please download it here.


Contig Sequence     [ Download ]
>Wh_EMI_all.Contig2166
CGGCGGCGGCGCGTAGCACAGGAGAAGGAGCAGGCGGCGGTGGTGCCCGA
AGACGAGAAGCACGGCGACCTAGCCCGAGCTCGCAACCATGGCTAGGGGT
TTGAAGAAGCATCTGAAGAGGCTCAATGCCCCGTCTCACTGGATGCTTGA
CAAGCTTGGTGGAGCTTTTGCCCCCAAGCCATCATCTGGTCCTCACAAGG
CCAGGGAGTGCCTTCCTCTGATCCTCATCCTGAGGAACAGACTGAAATAT
GCTCTCACCTACCGTGAAGTGCAGTCTATCCTTATGCAGCGTCATATCAT
GGTTGATGGAAAGGTCCGCACTGACAAGACCTACCCTGCTGGTTTCATGG
ACATCATTTCCATTCCCAAGACTGGTGAGAACTACAGGCTTCTGTATGAC
ACCAAGGGCCGCTTCCGCCTTCACTCTGTCAGGGATGAGGATGCTAAGTT
CAAGCTCTGCAAGGTCAGGTCTGTCCAGTTCGGCCAGAAGGGCATCCCCT
ACCTGAACACCTATGATGGCCGCACCATCCGCTACCCAGACCCTCTCATC
AAGGCCAATGACACTATCAAGCTCGACCTGGAGACCAACAAGATTGTTGA
CTTCATCAAGTTCGACGTTGGTAACGTGGTCATGGTGACTGGCGGGCGCA
ACACTGGGCGTGTTGGTGTGATCAAGAACAGGGAGAAGCATAAGGGAACC
TTCGAGACCATCCACGTTGAGGATGCCCAGGGCCACCAGTTCGCCACCCG
TCTGGGCAATGTATTCACCATTGGCAAGGGCACCAAGCCATGGGTGAGCC
TCCCCAAGGGCAAGGGTATCAAGCTCACCATCATTGAGGAGCAGAGGAAG
CGGGATGCCGCTGCCCAGGCTGCTGCCAAGGCCTGATTCTGAGGCGTTGA
GTCGTTTTGCTATAGCCAGTTATCTGCAAGGATATAGAACTATGTTCCTG
GAACCATCGTTTTTAAGTTTTGCCTGATGTTTGTTGATTTGCGAACTTCG
TGGTTGCCTCTAGATGTAATGTGGATGTTTATCTTATTAAGTGCTATTTC
GAGACCTCATCC
 
NBRP MacGene Copyright © 2012 NBRP-Wheat. All rights reserved.