Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_EMI_all.Contig2083
Contig Information
Length 795 bp
Tissue Dormant seed with water absorption after breaking
Clones 10 Clones [Download: CSV  ,  FASTA ]
whei1b24    whei6i02    whei15l05    whei17k11    whei20e09    rwhei1b24    rwhei6i02    rwhei15l05    rwhei17k11    rwhei20e09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to KIAA0774 [Ciona intestinalis]
Score 86
Evalue 1.04735
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig2083
TCAGCGGCTGCAGTACAGAGCTCATACCAGGACTGAAAAGAAAAGGAAATTACATCATAGTCATTGAAACTAACAAGGAGGACCCCATCCTGATGATTAA
GATTACAATCGGGTCCAATACTCAACTCCAGCGTAGATCCAGTCCGGCCATCACCGGGGACGTGGCCACTTGAGATCACTGGACCGCCACTACTCCATCT
CCGGACAAAGATGGAAGAAGAGGACTCCATGTTGAAGTTGAACAGCTGCCTCTCAAATGGCATCAAGCCAGGAGGAAGAAACGAAGCCAGCATGGCTTCA
CCAGGCCGCCCTTCGGCCAAAAATGTCACCGGGAAGGCGGCGGAGACCGGCAGCTCCAGTGGGCGCCGTAGCTCCACTCCAAGCACCGATGAGAATATGC
ACAAACCCAATCGAAACAAACTTGCGCTCCACCTCTTCCACTTTCTGTCCCCATCTCCACGACAGCGACGAACAAATGGAACAAGGCGACGGAGATCCTC
CAGATCAGGGAAAGATTCGAGCTTATTAGGGAAGCTATCACCAGATCTACCACCCGCTGTCAACTTCCACCATGGAAGCTCACCTCGGGAGAGAACCAGC
CGCCAGGCGCTGCTCGAGGACGCCTGGACGAAGCTCCAACTCGACATCACGTCAAACGCCACAGAGACAAACCTAGACTCAGTCCTAAACCTAATCTTAC
ACCTACTTGACGGAGGAGAGACCTGGCTACCTTCCCCATGCTCGCTCACGACGGCAGCACCGCCGGAGGAGGAGGGCCAAGGAGCCGGGCGACAC
page-top