Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_EMI_all.Contig2048
Contig Information
Length 810 bp
Tissue Dormant seed with water absorption after breaking
Clones 9 Clones [Download: CSV  ,  FASTA ]
whei1f15    whei7i10    whei10c03    whei19g07    whei19m15    rwhei1f15    rwhei7i10    rwhei19g07    rwhei19m15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative cyanate transporter [Escherichia coli IAI39] >gi|218368736|emb|CAR16477.1| putative cyanate transporter [Escherichia coli]
Score 89
Evalue 0.485645
Total Hit Count 23
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig2048
CTTTTTTGACAGAGAGGGATCCCGAAGGATCCCGAACTATTTATTCAGATAAAGAGAAGTACAACGTCTTACACAAAGGACCCTGAAGAAACAACAAACG
ACGAACAAGTCCTAGGACTTTTGCAAGAAGGACCTCAACCTAAAGATGGAAAACGCGATCAGGTCCACATCGTTCTCAGCGGATACACCTCGCCATCGCC
GGGGACGAGACCACTTGGGGCGACGAGGGAGCCATAGCAACCAGCCATGGCGACCGCCGGAACGAAGAACTGCCTCCCAAATGGCTACAAGGCCGGGAGG
AATGGAGATGGCCGCCCTTCGGCCAGAAGAAGCAGCAGAATGACGGCGACAACCGGCCATCGACCGCCACAGCAGGCGCCAGCTCCCCCACCGCAATAGC
TGCTGCTGTTGAGCTCGAACCCGATCTGACATCTTCAGATGACCGCTCCTCCCAAGCTCCCGCTCCATCACCGCAACGGCTTGAAGAAACCGGGAGAATC
GGCTGGCCTTCCTCCAGATCCGGGGCACGAAGACGACGCGCTTATTTAGAGAGCTAGCACCAGAAACATCATCTCCCCTTCGCCACCACCATGGGAGAAG
AGCAGAAGATGTCACCGGCGACCACCAGGCGCTGCGCGCAAGCGGCGGTGGATTGCGCTCCATCGGCATGACGCCAAACACCGGCACAAGGCCAAACTCC
ACAAAGGAAACACCTAGACTAGGCCAACTATTTACAACAGAGCGCCGCGCACCTCTCCCATCTCCTTCCCGACCGGCGTCGCCGGCGGCAAAGATCCAGG
ATCGGGCGGG
page-top