Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_EMI_all.Contig1971
Contig Information
Length 1045 bp
Tissue Dormant seed with water absorption after breaking
Clones 7 Clones [Download: CSV  ,  FASTA ]
whei1e08    whei4b21    whei4p12    rwhei1e08    rwhei2p16    rwhei4b21    rwhei4p12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit deleted in split hand/splt foot protein 1 [Zea mays] >gi|195629800|gb|ACG36541.1| deleted in split hand/splt foot protein 1 [Zea mays] >gi|195652413|gb|ACG45674.1| deleted in split hand/splt foot protein 1 [Zea mays] >gi|195653029|gb|ACG45982.1| deleted in split hand/splt foot protein 1 [Zea mays]
Score 125
Evalue 4.93435e-05
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1971
TTTTTTTTTTCAATAGACGGCTACCGCAGTGCCGGGACCAGACCATACGGGAATTCCTGCATGTCGACAAACTTCCGGGTAATTGCGATACTGTCTGGTA
ACTATCACTGTTCCACAAGTTGTGCTGCTCGCAGCCGATAACTACATGCAGTACGGTACAAAGTCTGATACACAGTACTGAAACGAAGATAAGTATCACA
GCTTGATATTGCTAGGGAAGTATCGCAGGTTCAGAGAGCAGTGGCCACACAGTGCCTGATCGAAGATAAAGTGTACTACAGCTTTGATATGGATGGGGAA
GTAGTTCAGCTCTTCTGAGTGTTGCCTCCCTCCAGCTCTTTCCTCAGCTGCAGTGAGAAATCGTCATTCACGTCGTCGTCATCCCAGTCATCCTCCCATT
GCTGGACAGCTTCGTTGCCATCTTCCTTGTCATCCCATTCTTGGTCGATCTCGAACTCCTCGAACTCGTCGTCGTCCTCGAGGAGGTCCATCTTGGCGGC
CTCCGCCTTCGCGTCCGCCGGTGCTGCCGCCGCCATCGATGCTGGTTCTAGTATCTAGCTGATTCGCGCCTCGTGCCGAATTCGGCACGAGGACTAAAAG
GACATGGCCTAAACATATATCTAATCTGCATACTACTACTACTGTGCGTTTCTCAAAATAAATAATTAAGGGGAGAGAAACAGAAACATAACCTAACCTA
AGCATATACTCCATACATAAGCGAAGTACTTGTTCTAATCACCATAAGATGTACAATGTTTTCTCCAGTAGATATGTATAAAAACATGAACATACGTGGC
TGTCAACTAAAAAGTTTCCATGAAACCAATGGCCCAGTCAAAATCGACGACACAAACCAAATCGATCACCTCAATCATCCCTAGGAGCTCCAATCCCAGG
GAGCTTAGTGATTTTAAGGATGTATTCAAAGAAAAAAACTGAATTTGATACTCCAAATATTAAAGTTTCCAGGATATTTCTAGTTTATTCAAATTTTGCG
CAGCGGCCGTCTCCTTCATCCTTGCCTCCTCTACCTCTGCCTGTA
page-top