Top | About the KOMUGI | Related Sites | Update | SiteMap | Contact Us
Quick Search   for   
  Strains ( NBRP / Others ) Genes / Marker cDNA TAC Map Comparative Map BLAST
  DNA Seq. Organelles Chromosomes Microarray eWIS Tools Story of wheat (Japanese only) Textpresso(TEST)
 Japanese | English

  BLAST
  Tissue specific clones
  complex contig list
Query Form

  How to use Virtual Display(2012)

  Related Sites
  Download
  How to Order Resources

  MTA Sample


• > Contig Detail
/images/estsTitleEn2.gif
cDNA - Contig Detail
Wh_EMI_all.Contig1971
Contig Information
Length 1045 bp
Tissue Dormant seed with water absorption after breaking
Clones
7 Clones   [Download: CSV , FASTA ]
whei1e08    whei4b21    whei4p12    rwhei1e08    rwhei2p16    rwhei4b21    rwhei4p12   
Assemble Result Assemble Viewer *
Homology (BLAST) Top Hit deleted in split hand/splt foot protein 1 [Zea mays] >gi|195629800|gb|ACG36541.1| deleted in split hand/splt foot protein 1 [Zea mays] >gi|195652413|gb|ACG45674.1| deleted in split hand/splt foot protein 1 [Zea mays] >gi|195653029|gb|ACG45982.1| deleted in split hand/splt foot protein 1 [Zea mays]
Score 125
Evalue 4.93435e-05
Total Hit Count 16

* Before using this tool, please ensure that you have the latest version of Java.
If you are not using the latest Java version, please download it here.


Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1971
TTTTTTTTTTCAATAGACGGCTACCGCAGTGCCGGGACCAGACCATACGG
GAATTCCTGCATGTCGACAAACTTCCGGGTAATTGCGATACTGTCTGGTA
ACTATCACTGTTCCACAAGTTGTGCTGCTCGCAGCCGATAACTACATGCA
GTACGGTACAAAGTCTGATACACAGTACTGAAACGAAGATAAGTATCACA
GCTTGATATTGCTAGGGAAGTATCGCAGGTTCAGAGAGCAGTGGCCACAC
AGTGCCTGATCGAAGATAAAGTGTACTACAGCTTTGATATGGATGGGGAA
GTAGTTCAGCTCTTCTGAGTGTTGCCTCCCTCCAGCTCTTTCCTCAGCTG
CAGTGAGAAATCGTCATTCACGTCGTCGTCATCCCAGTCATCCTCCCATT
GCTGGACAGCTTCGTTGCCATCTTCCTTGTCATCCCATTCTTGGTCGATC
TCGAACTCCTCGAACTCGTCGTCGTCCTCGAGGAGGTCCATCTTGGCGGC
CTCCGCCTTCGCGTCCGCCGGTGCTGCCGCCGCCATCGATGCTGGTTCTA
GTATCTAGCTGATTCGCGCCTCGTGCCGAATTCGGCACGAGGACTAAAAG
GACATGGCCTAAACATATATCTAATCTGCATACTACTACTACTGTGCGTT
TCTCAAAATAAATAATTAAGGGGAGAGAAACAGAAACATAACCTAACCTA
AGCATATACTCCATACATAAGCGAAGTACTTGTTCTAATCACCATAAGAT
GTACAATGTTTTCTCCAGTAGATATGTATAAAAACATGAACATACGTGGC
TGTCAACTAAAAAGTTTCCATGAAACCAATGGCCCAGTCAAAATCGACGA
CACAAACCAAATCGATCACCTCAATCATCCCTAGGAGCTCCAATCCCAGG
GAGCTTAGTGATTTTAAGGATGTATTCAAAGAAAAAAACTGAATTTGATA
CTCCAAATATTAAAGTTTCCAGGATATTTCTAGTTTATTCAAATTTTGCG
CAGCGGCCGTCTCCTTCATCCTTGCCTCCTCTACCTCTGCCTGTA
 
NBRP MacGene Copyright © 2012 NBRP-Wheat. All rights reserved.