Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_EMI_all.Contig1914
Contig Information
Length 752 bp
Tissue Dormant seed with water absorption after breaking
Clones 6 Clones [Download: CSV  ,  FASTA ]
whei1f22    whei1o14    whei5k11    whei6p02    rwhei1f22    rwhei1o14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit envelope glycoprotein [Human immunodeficiency virus 1]
Score 79
Evalue 6.06872
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1914
GAGGCGTGGCTGCCGGCACCCTCTCAGTTCGTGAACCCCGATCTGGAGAAGGAGATGGAGGAGGAAAGGAAGCTGATGCGAGAAAAGCTGAAGAAGGAGA
AGTCTGAGAAAAGGAAGTCAAGGAGCAAGTCAAAGAGCAAGAGGAAACATCGCGCCTTGGTGTCTGACTCCGACTCAGACTCTGAATCATCGGGGACCGG
CTCCGAGTACTCTTCTGAGAGCGGCAGCTCAAGCTACAGCTCCTCAGACTCGGAGGACAAGAAGAAGCGCCGACGCAAGACGATGCAAAAGAAGAGAAGG
CATCGGAGGGACAGCACGTCGTCGTCCTCCTCTAGGTCTGAATCTGAGTCCGAGTCTGATTCTGATTCTGACGGCAAGGGCAGCCGGAAGAAGAGCAAGA
AGCGCGGCGACAAGCGCCGATCCTGAAGAACCGGAGAAGGCGCCAGATGCGGCCGAATACTGCCCACATATCATGTGCTTTTCAGTGCAGCCGTGGCTTC
GAGTGCCGAGCGCCCTCTCAAGAGATATATTGCAAATGTATCAGTTGATTTCCTGAACGCTAGATGATTTCCTGTTATTGTTCCCCCTGTGCTAAGTAGT
ACTCTCTTTTATCCTAAAGATTACTAAGAACTTGGAAGTGCTTGAAGCTATAGATTGTTTCCTACCCTGTGATGCCTGTGAGCAGCAGCAAATCCTGCAA
CTATATTCATCATCATCTGTAAGCTTGTTGTGCTTGACTGCTGTGTAAAAAA
page-top