Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_EMI_all.Contig1889
Contig Information
Length 899 bp
Tissue Dormant seed with water absorption after breaking
Clones 6 Clones [Download: CSV  ,  FASTA ]
whei1c08    whei1d08    whei14h22    rwhei1c08    rwhei1d08    rwhei14h22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100192774 [Zea mays] >gi|195617050|gb|ACG30355.1| 40S ribosomal protein S9 [Zea mays]
Score 889
Evalue 9.99355e-94
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1889
CCCACCGGCGGCGCACAGCCCGACGACCCGAGCGATCCTGCGGAGGCGGCAGCCATGGTGCACGTCAACTTCTACCGCAACTATGGAAAGACCTTCAAGA
AGCCAAGGCGTCCGTATGAGAAGGAGCGTCTTGACGCTGAGCTGAAGCTGGTTGGGGAGTACGGTCTGCGGGCCAAGCGTGAGCTCTATCGTGTGCAGTA
TGCCCTCAGCCGCATCCGAAATGCTGCCAGGGAGCTGCTCACTCTGGATGAGAAGAACCCCCGCCGTATCTTTGAGGGTGCGGCTCTCCTCCGCCGCATG
AACCGCTACGGTCTTCTCACTGAGGAACAGAACAAGCTTGATTACGTGCTTGCCCTCACTGTTGACAACTTCCTCCAGCGCCGTCTCCAGACCATCGTCT
TCAAGAATGGCATGGCCAAGTCAATCCATCATGCGCGTGTCCTTATCAGACAGCGCCACATCAGGGTTGGAAAGCAGCTCGTCAACATTCCTTCTTTCAT
GGTGAGGGTGGACACTGAGAAACACGTCGACTTCTCGCTCACCAGCCCCCTTGGTGGTGGCCAACCTGGAAGAGTGAAGCGGAAGAACCAGAAGAAGGCC
TCAGGTGGTGGTGGTGATGACGGCGAGGAGGAGGAAGACTAAGCGCTCAGCCTCGACCCGCATAACTTCCGTTGCAGAAATGTTGAGATTGCCTTGTGGA
TCTTGCAACGGGAAATGATTCAAACTTTGGTTCGTTCTTAGAAACTTAGTGGTGTAGAGCTTTCGTTGCTTCAGAATCATTTGGCTATCGATTCTAAAAT
TAAACTTATGTTTGTTGGTTTTGCTTGGTTAGTGACTACCGAGCAGAAGAAGTGAACTCAGTGATGCTGCTTCGTTTTTTGTGAACCAAACGTATCTGT
page-top