Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_EMI_all.Contig1655
Contig Information
Length 1391 bp
Tissue Dormant seed with water absorption after breaking
Clones 4 Clones [Download: CSV  ,  FASTA ]
whei1c15    whei4f24    rwhei1c15    rwhei4f24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_20217 [Oryza sativa Indica Group]
Score 1650
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1655
ATGATGAGCGAGAAAGTACTTTGAACCAGCTGCTTGTAGAGATGGATGGATTTGGCACAACTGCCGGTGTTGTTGTTCTTGCTGGTACAAATAGACCTGA
CATCCTTGACAAGGCACTGCTAAGGCCTGGAAGATTTGATCGCCAGATAACAATTGACAAACCAGATATAAAGGGCCGTGATCAGATATTCCGCATATAT
CTTACAAAACTTAAATTGGACAATGACCCAACATATTTTTCGCAAAGGCTAGCTGCTTTGACACCTGGGTTTGCTGGAGCTGACATTGCGAATGTTTGTA
ATGAAGCTGCTTTGATTGCTGCAAGAACTGATGAAACTCAGATTACAATGCAGCATTTTGAGTCTGCAATTGATAGGATTATTGGTGGTTTAGAGAAGAA
AAACAAGGTAATTAGCAAACTGGAGCGCCGTACTGTTGCTTACCATGAAGCTGGGCATGCTGTTGCCGGATGGTTTTTAGAACATGCAGAGCCTCTTCTG
AAAGTTACAATTGTTCCCCGTGGAACAGCTGCTTTAGGCTTTGCACAGTATGTACCAAATGAGAATCTTTTGATGACAAAGGAGCAGCTCTTTGATATGA
CATGCATGACGTTAGGTGGCCGAGCTGCGGAGGAGGTTTTGATTGGAAGAATCTCGACTGGTGCCCAGAATGATCTGGAGAAAGTTACAAAGATGACATA
TGCGCAAGTTGCTGTGTATGGTTTCAGCGATAAGGTTGGTCTTCTATCCTTCCCCCAGCGGGGGGATGGCTTTGAAATGAACAAGCCTTACAGCAACCAA
ACCGCATCCATCATCGATACTGAGGTGAGGGAATGGGTCGCCAAGGCCTACAAAAGGACAGTTGAACTGTTGACGGAGAAGAAGGAACAAGTGGCTCTCA
TCGCTGAGTTGCTGCTGGAGAAGGAGGTCCTCCACCAGGACGATCTGACCAGGGTACTAGGAGACCGCCCCTTCAAGGCAGCCGAGCTAACAAACTACGA
CCTCTTCAAGCAGGGGTTCCAGGACGAAGATGGCAAGACCACAGAGCCCGCCAAGAACGCCGAGGTGCCCGACGACGACGGGCCGGCCGCCGCGCTTCCC
GACGTCGTCGTGCCGACGTAGAGATCCAGGGCGAACATCTACCCCGCTGTACCATGGCATGCTCTCATCCGATAGATTCTGGTTTTGTTGTTGCAGCATA
AGAAGAAAAAACTGTATAAATCAGCGCCCTCGTCTAAAAATCAGCCATGCCGGTTTTATCTATTAGCTGGAAGGGATGCAGTAGGCTTTCCGCAGCTGGC
GTGGCCCTGTTGTTCTTCAGCACGATGAAGCTGCTGGTCGAGGTTCATGCTCTGAACTTGTATTGGCGTCGCCAGACGTTTTGACGGATCC
page-top