Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_EMI_all.Contig1650
Contig Information
Length 858 bp
Tissue Dormant seed with water absorption after breaking
Clones 4 Clones [Download: CSV  ,  FASTA ]
whei1c23    whei4a10    rwhei1c23    rwhei4a10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L6 [Triticum aestivum]
Score 966
Evalue 1.09013e-102
Total Hit Count 344
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1650
GTCCACCGAAGAAATCACCAATGGCTCCGATGTCGAAGATGGCGCTCGGCATAAAGCGGGCGTCGAGATCGCACACCTACCACCGCCGCGGGCTTTGGGC
CATCAAGGCCAAGCACGGCGGCGCCTTCCCCAAGGCCGAGAAGCCGGCCGCCGTCGCCGAGCCCAAGTTCTATCCCGCTGATGATGTCAAGCCACGCACC
GTCAGCACACGCAAACCCCATCCCACCAAGCTCAGATCGACCATCACACCGGGCACGGTGCTGATCCTGCTCGCGGGGAGGTACATGGGGAAGCGCGTGG
TGTTCCTCAAGCAGCTCAAGTCCGGCCTTCTCCTCATCACTGGACCTTTCAAGATCAATGGCGTGCCAATCCGCAGAGTGAACCAGACTTACGTCATTGC
CACATCCACAAAGGTCGACATCTCTAAGGTTAATGTGCAGAAGTTTGATGACAAGTACTTTGCTAGGGAGAAGAAGACTAGGGCAAAGAAGACTGAGGGC
GAGCTATTTGAGTCGGAGAAGGAGGCAACCAAGAATTTGCCAGACTTCAAGAAGGATGACCAGAAGGTCATTGATGCCGAGTTGATCAAGGCTATCGTTG
CTGTCCCAGACCTTAAAAATTATCTTGGTGCCCGGTTCTCTCTCAGGGATGGCGACAAGCCGCATGAGATGACCTTCTAAGTTACCTGGTACAAGTTTCA
AGATCTGTCGAAGTATTTTTTGTCTAGTGTGTGTTCTGGTTCTGTACTTCTGATTTCTTTTGCCTGGTTGGTGAATATTTGATTTCCACTGCAGTCTGCC
TGCCAAATATTTTGAGAAGATAACTAGAAGTACCATCCCCTTTGTTGGCTGTGCGACA
page-top