Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_EMI_all.Contig1530
Contig Information
Length 690 bp
Tissue Dormant seed with water absorption after breaking
Clones 4 Clones [Download: CSV  ,  FASTA ]
whei1e06    whei1f13    rwhei1e06    rwhei1f13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit IQ calmodulin-binding motif family protein [Zea mays]
Score 487
Evalue 2.51548e-47
Total Hit Count 27
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1530
CCGAGATCAAGGGCAAAGGCTCGCTCGAGCCATGGTCGCATGCCTACACCTGGGAGGAGGACTTCACGCCTTCGACGACGACGAGGATGAGCTGGAGGTC
GAGGAGCGCAGGCTGGAGAAGCCCAAGAAGATCAAGGCCGCCGCCAAGGACAAGGAGGTTGACAAGAAGAAGAAGAAGCCGGCGAGGACGTGCGTCCAGA
TCGAGGAGATCCCTGAGGACAACACCGCCGGCTGCGACGCCATCCGCAAGGCCTTTGCCATGGGGAACGGCAAGGGGAAGGCCAAGGAGCTGTCGCCACA
GGATGCCGCGCTGCTCATCCAGATGAACTACAGGGCGCACCTCGCCCACCGCTCCCAGGTGCTCAGCTGCCTGCGCGATCTCGCCGTCGCCAAGGCCAAG
CTCAAGGAGCTCCGGTCCCTCTTCTACAACCTCTCCTATAGGCGCCGCCTCTCGCACGACCACGAGGAGCGCCAGAGGTTCTCCGAGAAGATCATTGTCC
TGCTCCTCACTGTCGAAGCGCTCGAGATTTGCTTAAGATCACGGAAGCTTGGGTTGATGGAGTGCTTGTATTTAGTTTTTGTTTTGACCTTGTGAAACTT
GCTACCTATGGATGAAACTATGTAATATTGATGAAACTATGTATATGTACGGATGAAACTTGCTACTATTGGTAACATGTAATTGCATAT
page-top