Top | About the KOMUGI | Related Sites | Update | SiteMap | Contact Us
Quick Search   for   
  Strains ( NBRP / Others ) Genes / Marker cDNA TAC Map Comparative Map BLAST
  DNA Seq. Organelles Chromosomes Microarray eWIS Tools Story of wheat (Japanese only) Textpresso(TEST)
 Japanese | English

  BLAST
  Tissue specific clones
  complex contig list
Query Form

  How to use Virtual Display(2012)

  Related Sites
  Download
  How to Order Resources

  MTA Sample


• > Contig Detail
/images/estsTitleEn2.gif
cDNA - Contig Detail
Wh_EMI_all.Contig1530
Contig Information
Length 690 bp
Tissue Dormant seed with water absorption after breaking
Clones
4 Clones   [Download: CSV , FASTA ]
whei1e06    whei1f13    rwhei1e06    rwhei1f13   
Assemble Result Assemble Viewer *
Homology (BLAST) Top Hit IQ calmodulin-binding motif family protein [Zea mays]
Score 487
Evalue 2.51548e-47
Total Hit Count 27

* Before using this tool, please ensure that you have the latest version of Java.
If you are not using the latest Java version, please download it here.


Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1530
CCGAGATCAAGGGCAAAGGCTCGCTCGAGCCATGGTCGCATGCCTACACC
TGGGAGGAGGACTTCACGCCTTCGACGACGACGAGGATGAGCTGGAGGTC
GAGGAGCGCAGGCTGGAGAAGCCCAAGAAGATCAAGGCCGCCGCCAAGGA
CAAGGAGGTTGACAAGAAGAAGAAGAAGCCGGCGAGGACGTGCGTCCAGA
TCGAGGAGATCCCTGAGGACAACACCGCCGGCTGCGACGCCATCCGCAAG
GCCTTTGCCATGGGGAACGGCAAGGGGAAGGCCAAGGAGCTGTCGCCACA
GGATGCCGCGCTGCTCATCCAGATGAACTACAGGGCGCACCTCGCCCACC
GCTCCCAGGTGCTCAGCTGCCTGCGCGATCTCGCCGTCGCCAAGGCCAAG
CTCAAGGAGCTCCGGTCCCTCTTCTACAACCTCTCCTATAGGCGCCGCCT
CTCGCACGACCACGAGGAGCGCCAGAGGTTCTCCGAGAAGATCATTGTCC
TGCTCCTCACTGTCGAAGCGCTCGAGATTTGCTTAAGATCACGGAAGCTT
GGGTTGATGGAGTGCTTGTATTTAGTTTTTGTTTTGACCTTGTGAAACTT
GCTACCTATGGATGAAACTATGTAATATTGATGAAACTATGTATATGTAC
GGATGAAACTTGCTACTATTGGTAACATGTAATTGCATAT
 
NBRP MacGene Copyright © 2012 NBRP-Wheat. All rights reserved.