Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_EMI_all.Contig1370
Contig Information
Length 421 bp
Tissue Dormant seed with water absorption after breaking
Clones 3 Clones [Download: CSV  ,  FASTA ]
whei1f06    rwhei1f06    rwhei2a02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_21840 [Oryza sativa Indica Group]
Score 103
Evalue 0.00335847
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1370
GACAAAAACAAAATCTAGTGGCTCAATAAAAACCCACTATAGCTGTCAGTTTTAATAGATCCAGATAAGCAACAACACTCCGAAAGGTTTAACTGCTAAT
CACAAATTTTGGGAATACAAAAGCTGGTAAAACCAGCCAGGGGTTTACAATCGCCTGCAGTTGTTTTGACATCCTCCGCTTCTTCAGTTCTGGGCTGCCG
CCGCCGGTGGCTGCTGCTGAGCACGAGGTGCTTGAGCCTGCTGCTGCCCTGCCGGCGCTGGTACCGGCTGCTGGGATGAACTCCCTTGTGGCTGCTGCGC
TGGGGGCGCCAGCATTGGCCGGTATGGTGGATACTGGGGTGGGTACGGCATGCGAGGCGGGGCCATGTAACCGCCGCCATATGGTGGGGGTGGGTAGTAT
GGAGGGTACTGANCACCCTGG
page-top