Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_EMI_all.Contig1228
Contig Information
Length 882 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei1a01    rwhei1a01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to insulin receptor substrate 1 [Danio rerio]
Score 95
Evalue 0.11303
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1228
CTGGGGCGGCTGGTGTACGGGGTGGCGTTCGTCGCCGTCGCCGGCGTCTTCTTCCTCACCCTTCACCTCTACCTCGCGCCCCTCCTCTACCTCTGCTCCA
GCTAGCGACGGACGCCATGATGTTGTCCTGGCTGTGGCTCTGTCGTGGTTGTTAGGCGGCGGTTTGTGGTTGGCCGATTCGTGCTTGTCTCCGGAAGAAA
TCCTCTTTCTGGTCTTAAGCCGGATCCGGCGAAGGCGACGGCGACACGCGCGGGCGTCGTACTCTTTCCTGGAAGCATCGTCCGGAAGCTGTGCTCCTTC
CCTCTCCTCACGTCCATGTCTTCGGAAGTTGTGCTCCTTCCCTCTCCCATGGCCGCCACAGCTTCGGAGGGGAACTTAGATCCGTTGTATCGTCTCGAAG
CAGCGGCCTCTTGCCCGCGTGCTTTGCTGAGGTGTTGGCTTCTTTTGGCGACGATGATGGCGTCAGGAGGAGTTAGGGTCGAGGCTCGGCTTCGATAGCC
GGATTAGCGTGTTTGATGTGCTTTTACGTGGTTTGCTTTATTGTTGCCAAATCGGAAATGCGGTTGGGCAAGTCCAGGTAGAGGTAGTGACGATGACATT
TGATCGTCTGCGGAGGGCTTGCTTGCTCTGAACCCTGCATATTTCCCTTGTGATTTGTGATACTCGTCGTTAAAGTTGTAGTGGTTTTTTTGCCATGGCC
CATAAGCCGAGAGTCCCTGTCGGACGCCCATGTGCGTCAAGAAGCTCTGGCTTCACACAGGGTCCATCCAACTGGGCCGGCCCAATTACAGTTCCAATAA
AAAACAATGCTTGAACACTGTAGTGGGACGGTTCTGTACCATCCGCTTCACTGTAGCGCCACGTTTTATTTTCGAATATCTG
page-top