Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_EMI_all.Contig1022
Contig Information
Length 220 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei1f14    rwhei1f14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein SNOG_01146 [Phaeosphaeria nodorum SN15] >gi|111069675|gb|EAT90795.1| hypothetical protein SNOG_01146 [Phaeosphaeria nodorum SN15]
Score 126
Evalue 7.22855e-06
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1022
CGAGTGATCCCATCTTTACAAAGGCGATTTACGACTCGAGCTTCAAGTATGTCAGCCCTGGACCGGCTGTCTACTCTGGTTAAGAGTGCGCCTGGCTGGT
GAGGGCGAGGATTGGTGGGGTGACGGCTGGGTATCATGGGGGAACTTCATTGTAAATAGTTGTTATCAAGCTTTGAATATTAGTAGGAACAATCCAATCG
ATATGTTGGCAAAAAAAAAA
page-top