Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_EMI_all.Contig940
Contig Information
Length 809 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei1b17    rwhei1b17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0681400 [Oryza sativa (japonica cultivar-group)] >gi|57164486|gb|AAK00965.2|AC079736_5 putative ubiquitin-conjugating enzyme E2 [Oryza sativa (japonica cultivar-group)] >gi|108710422|gb|ABF98217.1| Ubiquitin-conjugating enzyme family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549377|dbj|BAF12820.1| Os03g0681400 [Oryza sativa (japonica cultivar-group)] >gi|215737341|dbj|BAG96270.1| unnamed protein product [Oryza sativa Japonica Group]
Score 747
Evalue 2.41923e-77
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig940
GCATCCCCGTCGCGTCGCACCCCGCCGCTACACCAACCCACCCCACCCCACGTATTCCCCGCACCTTTCCCCCCTCCCCCGGCCTCGGCGAGACCGCGCG
CGGCGCGCCATGACGAGCTCCGCCTCCTCCTCCCCTTCCCGCAAGGTGCTGAGCAAGATCGCGTGCCTCCGGCTGCAGAAGGAGCTCGGGGAGTGGCAGG
CCAGCCCTCCCGGCGGCTTCACCTACAAGGTCTCCGACAACCTCCAGCGGTGGGTCATCGAGGTGTCGGGGGCGGAGGGGACGCTCTACGCCGGCGAGAC
GTACCGGCTGCAGGTTGACTTCCCGGAGCAGTACCCCATGGAGGCTCCACAGGTTATATTTATGCATCCGGCGCCGATGCATCCGCACATTTACAGCAAT
GGGCACATCTGTCTAGATATATTGTATGACTCGTGGTCACCAGCAATGACGGTCAGTTCCGTGTGCATCAGCATCTTGTCCATGTTGTCAAGTTCACCAG
CTAAGGAACGCCCATCCGATAACGATCGCTACGTCAGGAACTGCCGCAACGGGAGGTCTCCGAAGGAGACGAGGTGGTGGTTTCATGATGACAAAGTGTG
ATGGGCTCCAGCTGGTTTCTTCTTCCGGCATCAGCAGCTCTTATACATCATCATCCTGCCTACCGTAGTATGGCGTGCGTCGTTCATGAAAAGGATCATT
TAGGCAAGTATTTCAAGCCATCTATTTGGCGGCAAATTGACATGCCCATGTATGTGGTTTTGTACATGATGAACCTGCACCTGTATCAACTCCCGTGCTT
ACCAACTCT
page-top