Top | About the KOMUGI | Related Sites | Update | SiteMap | Contact Us
Quick Search   for   
  Strains ( NBRP / Others ) Genes / Marker cDNA TAC Map Comparative Map BLAST
  DNA Seq. Organelles Chromosomes Microarray eWIS Tools Story of wheat (Japanese only) Textpresso(TEST)
 Japanese | English

  BLAST
  Tissue specific clones
  complex contig list
Query Form

  How to use Virtual Display(2012)

  Related Sites
  Download
  How to Order Resources

  MTA Sample


• > Contig Detail
/images/estsTitleEn2.gif
cDNA - Contig Detail
Wh_EMI_all.Contig940
Contig Information
Length 809 bp
Tissue Dormant seed with water absorption after breaking
Clones
2 Clones   [Download: CSV , FASTA ]
whei1b17    rwhei1b17   
Assemble Result Assemble Viewer *
Homology (BLAST) Top Hit Os03g0681400 [Oryza sativa (japonica cultivar-group)] >gi|57164486|gb|AAK00965.2|AC079736_5 putative ubiquitin-conjugating enzyme E2 [Oryza sativa (japonica cultivar-group)] >gi|108710422|gb|ABF98217.1| Ubiquitin-conjugating enzyme family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549377|dbj|BAF12820.1| Os03g0681400 [Oryza sativa (japonica cultivar-group)] >gi|215737341|dbj|BAG96270.1| unnamed protein product [Oryza sativa Japonica Group]
Score 747
Evalue 2.41923e-77
Total Hit Count 500

* Before using this tool, please ensure that you have the latest version of Java.
If you are not using the latest Java version, please download it here.


Contig Sequence     [ Download ]
>Wh_EMI_all.Contig940
GCATCCCCGTCGCGTCGCACCCCGCCGCTACACCAACCCACCCCACCCCA
CGTATTCCCCGCACCTTTCCCCCCTCCCCCGGCCTCGGCGAGACCGCGCG
CGGCGCGCCATGACGAGCTCCGCCTCCTCCTCCCCTTCCCGCAAGGTGCT
GAGCAAGATCGCGTGCCTCCGGCTGCAGAAGGAGCTCGGGGAGTGGCAGG
CCAGCCCTCCCGGCGGCTTCACCTACAAGGTCTCCGACAACCTCCAGCGG
TGGGTCATCGAGGTGTCGGGGGCGGAGGGGACGCTCTACGCCGGCGAGAC
GTACCGGCTGCAGGTTGACTTCCCGGAGCAGTACCCCATGGAGGCTCCAC
AGGTTATATTTATGCATCCGGCGCCGATGCATCCGCACATTTACAGCAAT
GGGCACATCTGTCTAGATATATTGTATGACTCGTGGTCACCAGCAATGAC
GGTCAGTTCCGTGTGCATCAGCATCTTGTCCATGTTGTCAAGTTCACCAG
CTAAGGAACGCCCATCCGATAACGATCGCTACGTCAGGAACTGCCGCAAC
GGGAGGTCTCCGAAGGAGACGAGGTGGTGGTTTCATGATGACAAAGTGTG
ATGGGCTCCAGCTGGTTTCTTCTTCCGGCATCAGCAGCTCTTATACATCA
TCATCCTGCCTACCGTAGTATGGCGTGCGTCGTTCATGAAAAGGATCATT
TAGGCAAGTATTTCAAGCCATCTATTTGGCGGCAAATTGACATGCCCATG
TATGTGGTTTTGTACATGATGAACCTGCACCTGTATCAACTCCCGTGCTT
ACCAACTCT
 
NBRP MacGene Copyright © 2012 NBRP-Wheat. All rights reserved.