Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_EMI_all.Contig892
Contig Information
Length 878 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei1b20    rwhei1b20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PST19 [Triticum aestivum]
Score 111
Evalue 0.00156729
Total Hit Count 10
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig892
TTCGGTCACCGGCCTCACCCTGACCTGGCCCGGCTATAAATAGCCCCAGTACGTCGCGTTGGCCACGCACAAGCCCTCCCTCATCAGATCCATCACAACT
CCGCGCTACCCAAAACCTGGTGAAGATGTCGAGCAGCGGTGAGGTCGGCAACAGCCGTTGACGTGGGGTGGCTCAGGCGAGGTCCTGCCCCTTGTCGCTG
ACGCTGGACCAGGCAGAATATCTGGCGCGGTACAACGTCCTCATGCCGCCCGCATGCCGTCGGGCTGGCACATTAACAGCGGCGGCTACGCGGTCGAGGG
CCCCGTCGTCCCCCGCGACGAGCAGCAGTAGCGTCACGATGGCCGGTGCAACGCACATGGCCATCACGAATTCTGGGTGGGGAAGAACTTTGACGAGGTC
GTCGTGGAGGCTCGTCGACGGGAACTTGCCCACCGCCGGGCTTGCGTGGCGCGATATGTCCATCCTCCCCTGCCCCGCCTCATGTGGTCGCCCCAGCCTT
CGGCTGCGCCCGCGGTTGTTGCGAACCCAAGTTGGCAGCGCTCAGAGAGGCAAGCGACCCCGACGACATTTCCGACCTCTTCTGGGCGATCTGCGATCCG
CGACGGCTCAGGGATGGTTTCTGCCTCACGCACCTGGCGACCCAGATGACATGCCGGGGTGGAACAAGGCCTTCCGCCTGTCCATGAAGGCGATGGTGGC
AGCGAGGAAGACAACAACCTTGACTTCCTCGGCGCGGGCGGCAGCGACAACGATGACGACGACGGCCCGGGCGACGACGATGTCGGAGAGCTCGACTCTG
TCATGCTGGACGGCCCAAGTGACGACGAGTAGATTAGTTATTTAAAAAAAGTTAGTTCGAATTTCATTCCAATCTTGA
page-top