Top | About the KOMUGI | Related Sites | Update | SiteMap | Contact Us
Quick Search   for   
  Strains ( NBRP / Others ) Genes / Marker cDNA TAC Map Comparative Map BLAST
  DNA Seq. Organelles Chromosomes Microarray eWIS Tools Story of wheat (Japanese only) Textpresso(TEST)
 Japanese | English

  BLAST
  Tissue specific clones
  complex contig list
Query Form

  How to use Virtual Display(2012)

  Related Sites
  Download
  How to Order Resources

  MTA Sample


• > Contig Detail
/images/estsTitleEn2.gif
cDNA - Contig Detail
Wh_EMI_all.Contig500
Contig Information
Length 319 bp
Tissue Dormant seed with water absorption after breaking
Clones
2 Clones   [Download: CSV , FASTA ]
whei1d16    rwhei1d16   
Assemble Result Assemble Viewer *
Homology (BLAST) Top Hit Os08g0558300 [Oryza sativa (japonica cultivar-group)] >gi|45736097|dbj|BAD13128.1| hypothetical protein [Oryza sativa Japonica Group] >gi|113624462|dbj|BAF24407.1| Os08g0558300 [Oryza sativa (japonica cultivar-group)]
Score 207
Evalue 2.38215e-15
Total Hit Count 9

* Before using this tool, please ensure that you have the latest version of Java.
If you are not using the latest Java version, please download it here.


Contig Sequence     [ Download ]
>Wh_EMI_all.Contig500
CTCGCCGACGCCACGCGCCGCCACATGGAAGCTGGACGCTGTCGTGGAGA
TCGCGGGCGAGGCCGTCGTGCTGCTCTGGTCGCGCCGCTCCTCCGTCCGC
ATCGACAGCCACATCGTCGTCGACCCCGTCTTCCTCGAGGTCGTCGAGCA
GGACAACCGCTCCGAGATGCAGCTCTACCTAACCTGACCTCAGTTAGCTG
CTATGTGTATCACCACCTGAACCCTCCCTCAAAACCTTATTCGTCTGTGT
GTGCTTTGAAATGAAATGCAATGCAATCTTTCCCAATTCCAAGCAATGAA
ATGCAATGCAAAAAAAAAA
 
NBRP MacGene Copyright © 2012 NBRP-Wheat. All rights reserved.