Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_EMI_all.Contig500
Contig Information
Length 319 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei1d16    rwhei1d16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0558300 [Oryza sativa (japonica cultivar-group)] >gi|45736097|dbj|BAD13128.1| hypothetical protein [Oryza sativa Japonica Group] >gi|113624462|dbj|BAF24407.1| Os08g0558300 [Oryza sativa (japonica cultivar-group)]
Score 207
Evalue 2.38215e-15
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig500
CTCGCCGACGCCACGCGCCGCCACATGGAAGCTGGACGCTGTCGTGGAGATCGCGGGCGAGGCCGTCGTGCTGCTCTGGTCGCGCCGCTCCTCCGTCCGC
ATCGACAGCCACATCGTCGTCGACCCCGTCTTCCTCGAGGTCGTCGAGCAGGACAACCGCTCCGAGATGCAGCTCTACCTAACCTGACCTCAGTTAGCTG
CTATGTGTATCACCACCTGAACCCTCCCTCAAAACCTTATTCGTCTGTGTGTGCTTTGAAATGAAATGCAATGCAATCTTTCCCAATTCCAAGCAATGAA
ATGCAATGCAAAAAAAAAA
page-top