Top | About the KOMUGI | Related Sites | Update | SiteMap | Contact Us
Quick Search   for   
  Strains ( NBRP / Others ) Genes / Marker cDNA TAC Map Comparative Map BLAST
  DNA Seq. Organelles Chromosomes Microarray eWIS Tools Story of wheat (Japanese only) Textpresso(TEST)
 Japanese | English

  BLAST
  Tissue specific clones
  complex contig list
Query Form

  How to use Virtual Display(2012)

  Related Sites
  Download
  How to Order Resources

  MTA Sample


• > Contig Detail
/images/estsTitleEn2.gif
cDNA - Contig Detail
Wh_EMI_all.Contig477
Contig Information
Length 683 bp
Tissue Dormant seed with water absorption after breaking
Clones
2 Clones   [Download: CSV , FASTA ]
whei1c07    rwhei1c07   
Assemble Result Assemble Viewer *
Homology (BLAST) Top Hit Os01g0663500 [Oryza sativa (japonica cultivar-group)] >gi|55773842|dbj|BAD72380.1| PCD/DCoH-like protein 2-like [Oryza sativa Japonica Group] >gi|113533318|dbj|BAF05701.1| Os01g0663500 [Oryza sativa (japonica cultivar-group)] >gi|215765001|dbj|BAG86698.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765606|dbj|BAG87303.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218188797|gb|EEC71224.1| hypothetical protein OsI_03159 [Oryza sativa Indica Group]
Score 515
Evalue 1.39628e-50
Total Hit Count 500

* Before using this tool, please ensure that you have the latest version of Java.
If you are not using the latest Java version, please download it here.


Contig Sequence     [ Download ]
>Wh_EMI_all.Contig477
GCCACTTCACCGCGAGCCCCACTGACCCTCAAAGGCCTCAACATGGCAGG
TCTGCTGCTGCGTACATTCATCCGGATCCAGCCCCGGGCGCCGATGAGCG
CCGCCGGTGGAGCCGCGCCCTTCTACGCCTCGTGTCCCTCGTCGCCCCGC
ACCGTCGCGCACCTGGAGGTGAGGGGGGAGCAGGCCGCTGCTGAAGTTGA
ATTATCAAAGAAGAGTTGTATCCCATGCATTTCAAAGGATCTGCATGCCA
TGTCAGAAGATTCTGCTAAAAAGTCACTTGAACAGGTGACTGGTTGGGAA
CTGAAAAATGAAGGTGACATTTTGAAATTACACAGAGCATGGAAGGTGAA
GAATTTTGTAAAAGGTCTTGAGTTCTTTCAGCTTGTTGCTGCTGTTGCTG
AGGAAGAAGGTCACCACCCAGATCTTCATCTCGTCAGTTGGAACAATGTG
AAAATCGATGTCTGGACTCATTCAGTCAGAGGTTTAACAGATAATGACTT
CATCCTTGCTGCAAAGATCAATGAACTCAAGCTAGAAGGCCTTTTGAGCA
AGAAAAAGGCTACTTCCCAGGAGTAGCTTTGGGAGATCAAGCAGATAACT
TTTAATGTGTAGATGCCAAGAAATGCCCTTTTATATTGTCTGCGATGATT
GTACATGCCGTTCCAAAATGAGTACTTCCGATG
 
NBRP MacGene Copyright © 2012 NBRP-Wheat. All rights reserved.