Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_EMI_all.Contig477
Contig Information
Length 683 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei1c07    rwhei1c07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0663500 [Oryza sativa (japonica cultivar-group)] >gi|55773842|dbj|BAD72380.1| PCD/DCoH-like protein 2-like [Oryza sativa Japonica Group] >gi|113533318|dbj|BAF05701.1| Os01g0663500 [Oryza sativa (japonica cultivar-group)] >gi|215765001|dbj|BAG86698.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765606|dbj|BAG87303.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218188797|gb|EEC71224.1| hypothetical protein OsI_03159 [Oryza sativa Indica Group]
Score 515
Evalue 1.39628e-50
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig477
GCCACTTCACCGCGAGCCCCACTGACCCTCAAAGGCCTCAACATGGCAGGTCTGCTGCTGCGTACATTCATCCGGATCCAGCCCCGGGCGCCGATGAGCG
CCGCCGGTGGAGCCGCGCCCTTCTACGCCTCGTGTCCCTCGTCGCCCCGCACCGTCGCGCACCTGGAGGTGAGGGGGGAGCAGGCCGCTGCTGAAGTTGA
ATTATCAAAGAAGAGTTGTATCCCATGCATTTCAAAGGATCTGCATGCCATGTCAGAAGATTCTGCTAAAAAGTCACTTGAACAGGTGACTGGTTGGGAA
CTGAAAAATGAAGGTGACATTTTGAAATTACACAGAGCATGGAAGGTGAAGAATTTTGTAAAAGGTCTTGAGTTCTTTCAGCTTGTTGCTGCTGTTGCTG
AGGAAGAAGGTCACCACCCAGATCTTCATCTCGTCAGTTGGAACAATGTGAAAATCGATGTCTGGACTCATTCAGTCAGAGGTTTAACAGATAATGACTT
CATCCTTGCTGCAAAGATCAATGAACTCAAGCTAGAAGGCCTTTTGAGCAAGAAAAAGGCTACTTCCCAGGAGTAGCTTTGGGAGATCAAGCAGATAACT
TTTAATGTGTAGATGCCAAGAAATGCCCTTTTATATTGTCTGCGATGATTGTACATGCCGTTCCAAAATGAGTACTTCCGATG
page-top