|
CLSTR10173
| Merge cluster information | |||
|---|---|---|---|
| Name | CLSTR10173 | ||
| Library | ALL | 2 | cDNA [Download: FASTA] |
| olea | 0 cDNA | ||
| oleb | 0 cDNA | ||
| olec | 0 cDNA | ||
| olvl | 0 cDNA | ||
| olli | 0 cDNA | ||
| olbr | 2 |
cDNA [Download: FASTA] rolbr10a01 rolbr26a11 |
|
| olgi | 0 cDNA | ||
| olki | 0 cDNA | ||
| olsp | 0 cDNA | ||
| olte | 0 cDNA | ||
| olova | 0 cDNA | ||
|
Before using Assemble Viewer, please ensure that you have the latest version of Java. If you are not using the latest Java version, please download it here. http://java.com/ja/download/ |
| Contig information - 1 | |
|---|---|
| Name | Contig1 |
| Clone count | 2 clones |
| Length | 191 |
| Assemble Result | Assemble Viewer |
| Homology(BLAST) | |
| Top Hit | putative two-component system sensor protein, without kinase domain [Algoriphagus sp. PR1] |
| Score | 75 |
| Evalue | 7.75116 |
| Detail |
|
| Sequence |
[Download: FASTA] >Contig1 CAGACAACATATAGTTCGAGGCAACTTCGGCTGTCAAAGGACACTTCCAGTCCAAATTTCGGTTT CATTTACAAATAGTCAAATATCCTATGCGGTTCCACCCGTTTTTTTTACCTGGAGAACCGGCTAG CAGCGCCGGAAGTGGGACTTTGGTGGTTCTTTTTCTTCTCTGAAGTGCAGCACCAGCACTA |
