|
olvl33l16
| Clone Detail | |
|---|---|
| clone name | olvl33l16 |
| accession no | DK237472 |
| direction | 5' |
| tissue cluster | CLSTF00113 (91) |
| merge cluster | CLSTF00113 |
| Sequence |
gaggatccgacatgacttcacccgcgctgttgctgaccttcatcagtggcctcactgtggcccac tacgctgctgctggaccttatgagccatgcccttttgatccatgtatcgtcttgaaggagatcaa tgcgttgaaagaagctttggaagccagagatgtacccaaagtagctttttctgcccgaacgtcta agggtggagcctatggaaatttccagggtgacacaaccctgacctacaatgcagtgataaccaat gttggggatgcttataatccacccacagcaggtgtcgccacagcgaacgagtcgcatggtaaact tggcaatgttttacgccggatgccattcctgacccaaccctctcaaagcaaccgggcttgggacc ggcacagaagtagagaagggaacagggagcaacccggagtcgaaccctggtttcacggacggacg gcgccgcaaaccgccacgagctaaaccggctctcacttaattttgacaattaaatgatcaaaaat aatcagaaaattcctcttaaaattgcccctgcgcttcataatctgaataactttgtaagcaaata |
| Note | |
| Request |
|
| Reference |
|
| Homology(nr) | |
| Score | 133 |
| E-Value | 1.50788e-06 |
| definition | PREDICTED: similar to C1q-like adipose specific protein [Danio rerio] |
| Homology(Genome) | |
| Chr. no | 18 |
| From | 22239168 |
| To | 22239467 |
| Strand | + |
| Genome Viewer |
(Genome Viewer)
|
