|
roleb62l21
| Clone Detail | |
|---|---|
| clone name | roleb62l21 |
| accession no | DK134215 |
| direction | 3' |
| tissue cluster | CLSTR00349 (66) |
| merge cluster | CLSTR00128 |
| Sequence |
caacagggccaaagcccatgntcgtcatccgactcttcagattcctctttcttctcttccttctt ctcctcgacagctgcagcaggagctgcggctccacctgcaccaccagctgcagagctggcaacag caacagcaccacctgctggcatgctggccagcttgctgtaaccagcagcaatcacctcctcgaca ttcttgcctttgagctcagagaggaccttccccaggcgttcactatcagcttcaatgccaacact gtccaggatcttcttgatgtcaccagcttcagggttgccattgccacccagggcagcgagcagat aagcagcaacgtaacgcatcttgagctaggctggcgaacgcgtgtttcctacagggctggcacgg acagaaagc |
| Note | |
| Request |
|
| Reference |
|
| Homology(nr) | |
| Score | 190 |
| E-Value | 2.16012e-13 |
| definition | PREDICTED: similar to 60S acidic ribosomal protein P2 [Rattus norvegicus] |
| Homology(Genome) | |
| Chr. no | 3 |
| From | 16381779 |
| To | 16385073 |
| Strand | + |
| Genome Viewer |
(Genome Viewer)
|
