rMF015DA037b16
Clone Detail | |
---|---|
clone name | rMF015DA037b16 |
accession no | |
direction | 3' |
tissue cluster | CLSTR00815 (46) |
merge cluster | CLSTR00123 (688) |
Sequence |
cttcngagaagcacaacggttcaggtgatgacttcagacctcatcatgtcgcccttcatcttttc cttaagaggaaacctgtgaggaggatgtcacaaccactccgtccttgatctcctcagtgaccaca atgatctttttggtcgnggtggaggaagtgctggaggatttggaagaagaggtggaggaggtttg cgtggcctctccatccaacagccttctgnattctgcaatctccatctccagtctggncttgatgt canacaagatctggtattctcgacnttggngt |
Note | |
Request | |
Reference | |
Homology(nr) | |
Score | 211 |
E-Value | 1.52622e-15 |
Frame | -2 |
definition | novel protein similar to type I cytokeratin, enveloping layer [Danio rerio] |
Homology(Genome) | |
Chr. no | 1 |
From | 31984626 |
To | 31984822 |
Strand | - |
Genome Viewer | (Genome Viewer) |