OLA05-Ab11
Clone Detail | |
---|---|
clone name | OLA05-Ab11 |
accession no | |
direction | |
tissue cluster | |
merge cluster | |
Sequence |
caaatccacagatcagagcagtggtgaccaaaaagcagcaactaactttgcttcccacagaggag ctcagatgagccgctctgctcctgtgcattacagctctcattcaagcggcgtctctcagccagtt ccagtgttcgtgcagaatcctggtgtccctcagtttgttcccatggttccatcaggcagcagctt gagctctgctgtggcaggataccctgtggctgttcagacaggatctactgttcatgtgttttccg gtgttcctgcagcaggagtctctgagtcagttcaggtccctgtgcaggctcctggtttctcccag tttgttcagacgggcccagcaatggttggctctgcttcccctgtgtttgtgctgcatgaaggagc tggttccacacagccaggacctgctcaagctgctctgccagaaacccagtgggctgttgctcctc catctttctctgagcaagcagcagctgatgcccaggctgtgggctccagtg |
Note | |
Request | |
Reference | |
Homology(nr) | |
Score | 110 |
E-Value | 0.000873349 |
Frame | -1 |
definition | RecName: Full=Mediator of RNA polymerase II transcription subunit 15; AltName: Full=Mediator complex subunit 15; AltName: Full=Transcription regulatory protein GAL11 |
Homology(Genome) | |
Chr. no | 12 |
From | 24704845 |
To | 24705275 |
Strand | - |
Genome Viewer | (Genome Viewer) |