|
roleb48n03
| Clone Detail | |
|---|---|
| clone name | roleb48n03 |
| accession no | DK129581 |
| direction | 3' |
| tissue cluster | CLSTR00810 (61) |
| merge cluster | CLSTR00231 |
| Sequence |
gtcgagaaacgggaaagtggcttatttctgctgggctgctttccttgctgccttcatgcctttct tgttgtgtttcttagcaaaacgcatattcctcagaaacttggggtccaccccttttagggactca taacgctgagacctgggcttcttgatgccgtttctatgggctttgcgggactggttgtgagttgt gtggttcttcgactttgccatatcgacgtttaagaatctgtcacacgtacagacgacaaccggaa gagc |
| Note | |
| Request |
|
| Reference |
|
| Homology(nr) | |
| Score | 272 |
| E-Value | 6.64646e-23 |
| definition | PREDICTED: similar to Ribosomal protein L29 [Pan troglodytes] |
| Homology(Genome) | |
| Chr. no | 5 |
| From | 8466876 |
| To | 8469929 |
| Strand | + |
| Genome Viewer |
(Genome Viewer)
|
