|
rMF01SSA001e01
| Clone Detail | |
|---|---|
| clone name | rMF01SSA001e01 |
| accession no | |
| direction | 3' |
| tissue cluster | CLSTR00029 (1) |
| merge cluster | CLSTR00501 (1) |
| Sequence |
aacggtcatgtttcttctgcccttgacaatttacacgtacggcacattcgtactctcatactttt ccccggtaaaattcacacagcacatcatgctgcatcgcacgcacgcatgcagctgagcatcaaca gccgacggcggcggacgggcaatcaacggccagctcacaggctgggcaccctctcggcggcgccg gagatgacggtgagcaggttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaaggg cccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgt tcttgatctccttcaccttgagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcg aacgggccgcctgggtgga |
| Note | |
| Request |
|
| Reference |
|
| Homology(nr) | |
| Score | 419 |
| E-Value | 1.14836e-39 |
| Frame | -3 |
| definition | Precursor of CP29, core chlorophyll a/b binding (CAB) protein of photosystem II (PSII) [Hordeum vulgare subsp. vulgare] |
| Homology(Genome) | |
| Chr. no | 5 |
| From | 11349906 |
| To | 11349925 |
| Strand | + |
| Genome Viewer |
(Genome Viewer)
|
