Mohsen Mohammadi*, Davoud Torkamaneh, Majid Hashemi, Rahim Mehrabi, Amin Ebrahimi
Molecular Genetics Unit, Cereals Research Department, Seed and Plant Improvement Institute, (SPII) P.O. Box 4119, Karaj, Iran
*Corresponding Author: Mohsen Mohammadi, PhD (E-mail: mohsen@ualberta.ca)
Abstract
High throughput sequencing technologies have enhanced our knowledge of variations in genetic sequences. Consequently, breeding programs around the world are incorporating genomic assisted selection into their projects. PCR applications relevant to plant breeding often depend on small quantities of DNA suitable for quick diagnostic tests for a relatively large number of samples. The method presented here is a modification of existing protocols. We eliminated heating incubations and omitted usage of potentially noxious chemicals. DNA extraction from wheat, barley, and triticale grains was conducted and the utility of extracted wheat DNA was tested by using molecular markers for a stem rust resistance gene (Sr26), photoperiod sensitivity locus (Ppd-D1), and adult plant resistance gene block (Yr18-Lr34).
Keywords: DNA extraction, grains, marker assisted selection, small grains, wheat
Introduction
High throughput sequencing technologies have increased the wealth of knowledge concerning variations in nucleotide sequences. This enhanced knowledge has led to the development and application of allele specific PCR protocols for a variety of breeding goals. To achieve these goals with more precision, conventional breeding programs tend to adopt marker assisted selection (MAS) routines. Molecular markers such as RFLP and AFLP require large quantities of high quality DNA. Conversely, MAS and other applications related to quick DNA diagnostic tests for a relatively large number of samples require a fast and inexpensive DNA isolation procedure. Wheat grain endosperm contains a large quantity of DNA as a result of increases in the number of cells and nuclei and also increases in the DNA content of existing nuclei (Chojecki et al. 1986). Few experimental protocols are available describing DNA isolation from wheat grains. They usually differ in concentration of reagents used and incubation periods. Kamel et al. (2011) reported a DNA extraction protocol from germinated seeds based on the fact that a germinated seed is free of polysaccharides and polyphenols. Their protocol uses 1% polyphenolpyrollidine (PVP) in an extraction buffer. Another protocol available online at www.chem.iitkgp.ernet.in/faculty/SDG/DNAExp3.pdf requires chemicals such as β-mercaptoethanol, chloroform, and phenols. We have modified this protocol by eliminating the use of specific chemicals (i.e., β-mercaptocthanol, chloroform, and phenols) and heating incubations. We extracted DNA from wheat, barley, and triticale and demonstrated the utility of extracted wheat DNA by using molecular markers. Besides wheat breeding programs, other industrial, research, and developmental organizations, such as those involved in grain quality testing, seed homogeneity testing, genbanks and germplasm storage establishments where a large number of accessions are maintained, grain cultivar registration programs, regulatory bodies, and food processing companies may become users of this fast and inexpensive protocol.
Materials and Methods
Individual wheat, barley, and triticale grains wrapped in aluminum foil were crushed to a course powder, which was then ground into a fine powder using a pestle and mortar. The powder was placed into a 1.5 mL sterile tube. Extraction buffer [500 μL; 100 mM Tris/HCl pH 8.0, 50 mM EDTA pH 8.0, 500 mM NaCl, freshly supplemented with 1% (w/v) SDS] was added. The sample was vortexed vigorously for 1 minute. Potassium acetate (100 μL; pH= 5.2) was added and the solution was vortexed vigorously for another 1 minute until it turned milky white. The tubes were centrifuged at 15700 rcf for 10 minutes at 4oC. The upper layer was aspirated and added to a new sterile 1.5 mL tube. To precipitate DNA, 350 μL of pre-chilled on ice isopropanol was added to each sample, which was incubated at -20oC for 30 minutes. The DNA was then pelleted by centrifugation at 15700 rcf for 5 minutes at 4oC. The pellet was washed with 300 μL of pre-chilled 70% (v/v) ethanol and centrifuged at 15700 rcf for 5 minutes at 4oC. The ethanol was discarded and the pellet was dried at room temperature for 10 minutes. The DNA samples were dissolved in 50 μL of nuclease-free ddH2O (and / or TE buffer) and treated with 3 μL of RNase (10 mg/mL). Once dissolved in ddH2O or TE buffer, DNA samples were analyzed in 0.8% (w/v) agarose gels (Figure 1A and 1B). For imaging and photography, a Gel Document system (UVItec Limited, Cambridge, UK) was used. DNA was extracted from six genotypes / cultivars for use in a PCR based diagnostic test to demonstrate the utility of the DNA samples. The germplasm used were Eagle (disease test germplasm positive for stem rust resistance gene ‘Sr26’ from Australia), Shiroodi (introduced from Centro Internacional de Mejoramiento de Maiz y Trigo - CIMMYT), Navid (introduced from USA), Tabassi (landrace from Iran), Bam (doubled haploid derived cultivar developed in Iran), and Sabalan (wheat cultivar developed conventionally in Iran). We tested allelic forms of three genes i.e., Sr26 (stem rust resistance gene), Ppd-D1 (photoperiod sensitivity), and Yr18-Lr34 (combined resistance gene). PCR reactions were performed in 25 μL final volumes containing 1 μl DNA, 2.5 μl 10X Taq buffer, 1.5 mM MgCl2, 1 μl dNTP mix (2.5 mM of each dNTP), 0.4 pmol of each primer, and 1 unit of Taq polymerase. PCR amplifications were conducted in an Eppendorf MastercyclerR (Eppendorf AG, Hamburg, Germany). PCR for multiplex Sr26#43 (Fwd 5'-AATCGTCCACATTGGCTTCT-3' / Rev 5'-CGCAACAAAATCATGCACTA-3') and BE518379 (Fwd 5'- AGCCGCGAAATCTACTTTGA -3' / Rev 5'- TTAAACGGACAGAGCACACG -3') was initiated with a denaturing step of 94oC for 3 min, followed by 35 cycles of denaturation at 94oC for 1 min, annealing at 60oC for 1 min, and extension at 72oC for 1 min. The amplification was terminated by a final extension of 72oC for 10 min. For the Ppd-D1 locus PCR diagnostic test, we used a multiplexed marker system reported by Beales et al. (2007). This marker system involves three oligonucleotide primers Ppd-D1_F 5'- ACGCCTCCCACTACACTG-3', Ppd-D1_R1 5'- TTGGTTCAAACAGAGAGC-3', and Ppd-D1_R2 5'- CACTGGTGGTAGCTGAGATT-3'. The PCR program for the Ppd-D1 multiplex marker system consisted of an initial denaturation at 94oC for 2 min, followed by 35 cycles of 94oC for 30 s, 52oC for 30 s, and 72oC for 1 min. The amplification was terminated by a final extension step of 72oC for 5 min. csLV34 (Fwd 5'- GTTGGTTAAGACTGGTGATGG-3' / Rev 5'- TGCTTGCTATTGCTGAATAGT-3') was amplified with an initial denaturing step of 94oC for 5 min, followed by 35 cycles of denaturation at 94oC for 45 s, annealing at 55oC for 30 s, and extension at 72oC for 40 s. PCR was terminated by an extension step of 72oC for 10 min. PCR products were stained by ethidum bromide and separated by 1.5% (w/v) agarose gel electrophoresis.
Results and Discussion
The DNA extracted from wheat cultivars were characterized by means of Nanodrop ND-1000 (Thermo Scientific, CA, USA). A minimum DNA concentration of 500 ng/μL was obtained from wheat cultivars. Absorbance (260 nm/280 nm) ratios measured were within the acceptable range [min = 1.60, max = 1.82] indicating that the DNA samples were not contaminated with protein. However, the ratios observed for 260 nm/230 nm were slightly low [min = 1.2, max = 1.82]. The lower magnitude of ratio is probably due to the initial amount of NaCl in the extraction buffer, or the presence of polysaccharides or residual ethanol. For the Sr26 diagnostic test, we followed the codominant marker system developed by Liu et al. (2009). In this marker system, Sr26#43 is dominant positive (207 bp) and BE518379 is dominant negative (303 bp) for the presence or absence of the stem rust resistance gene 'Sr26', respectively (Figure 2A). For the Ppd-D1 locus PCR diagnostic test, we used a multiplexed marker system reported by Beales et al. (2007). In this marker system primers Ppd-D1_F and Ppd-D1_R1 amplify a 414 bp fragment from photoperiod sensitive allele Ppd-D1b whereas primers Ppd-D1_F and Ppd-D1_R2 amplify a 288 bp fragment from photoperiod insensitive allele Ppd-D1a (Figure 2B). We also tested the utility of the DNA samples by using the csLV34 marker as described by Lagudah et al. (2006). csLV34 indicates the presence of Yr18-Lr34 by amplifying a 150 bp PCR product and the absence of Yr18-Lr34 by amplifying a 229 bp PCR fragment (Figure 2C).
Acknowledgement
The authors are thankful to Dr. William Yajima for editorial help.
References
Beales J, Turner A, Griffiths S, Snape J,and Laurie D (2007) A pseudo-response regulator is misexpressed in the photoperiod insensitive Ppd-D1a mutant of wheat (Triticum aestivum L.). Theoretical Applied Genetics 115: 721-733.
Chojecki A, Bayliss M, and Gale, M (1986) Cell Production and DNA accumulation in the wheat endosperm, and their association with grain weight. Annals of Botany 58: 809-817.
Kamel AE, Bahkali A, Moslem M, Amin OE, and Niessen L (2011) An Optimized Protocol for DNA Extraction from Wheat Seeds and Loop-Mediated Isothermal Amplification (LAMP) to Detect Fusarium graminearum Contamination of Wheat Grain. International Journal of Molecular Sciences 12: 3459-3472.
Lagudah E, McFadden H, Singh R, Huerta-Espino J, Bariana H, Spielmeyer W (2006) Molecular genetic characterization of the Lr34/Yr18 slow rusting resistance gene region in wheat. Theoretical Applied Genetics 114: 21-30.
Liu S, Yu L, Singh R, Jin Y, Sorrells M, and Anderson J (2009) Diagnostic and co-dominant PCR markers for wheat stem rust resistance genes Sr25 and Sr26. Theoretical and Applied Genetics 120: 691-697.